Regulates Egg-Laying Behavior via a PLC -Independent and Serotonin-Dependent Signaling Pathway and Likely Functions Both in the Nervous System and in Muscle

egl-30 encodes the single C. elegans ortholog of vertebrate G q family members. We analyzed the expression pattern of EGL-30 and found that it is broadly expressed, with highest expression in the nervous system and in pharyngeal muscle. We isolated dominant, gain-of-function alleles of egl-30 as intragenic revertants of an egl-30 reduction-of-function mutation. Using these gain-of-function mutants and existing reductionof-function mutants, we examined the site and mode of action of EGL-30. On the basis of pharmacological analysis, it has been determined that egl-30 functions both in the nervous system and in the vulval muscles for egg-laying behavior. Genetic epistasis over mutations that eliminate detectable levels of serotonin reveals that egl-30 requires serotonin to regulate egg laying. Furthermore, pharmacological response assays strongly suggest that EGL-30 may directly couple to a serotonin receptor to mediate egg laying. We also examined genetic interactions with mutations in the gene that encodes the single C. elegans homolog of PLC and mutations in genes that encode signaling molecules downstream of PLC . We conclude that PLC functions in parallel with egl-30 with respect to egg laying or is not the major effector of EGL-30. In contrast, PLC -mediated signaling is likely downstream of EGL-30 with respect to pharyngeal-pumping behavior. Our data indicate that there are multiple signaling pathways downstream of EGL-30 and that different pathways could predominate with respect to the regulation of different behaviors. C elegans G q is encoded by egl1996), it is likely that the biochemistry of signaling is well conserved between C. elegans and mammals. We 30 (Brundage et al. 1996). In mammals, on the employed a genetic approach in C. elegans to further basis of sequence similarity the G q family is represented characterize EGL-30-mediated signaling pathways. To by four members: G q, G 11, G 14, and murine G 15/ this end, we screened for mutations that were able to human G 16 (Wilkie et al. 1991). Mutations in egl-30 phenotypically suppress a reduction-of-function allele, were originally identified because of their egg-layingegl-30(md186). egl-30(md186) mutants are lethargic, exdefective phenotype (Trent et al. 1983). Subsequent hibit slow pharyngeal pumping, and lay eggs at a later characterization and identification of additional egl-30 stage of development than do wild type. mutant alleles revealed that egl-30 is involved with the From our suppressor screen, two intragenic revertants regulation of many behaviors, including egg laying of egl-30(md186) that increase egl-30 function were iso(Trent et al. 1983; Brundage et al. 1996), pharyngeal lated. We used these mutants and another strong egl-30 pumping (Brundage et al. 1996), movement (Brundgain-of-function mutant (Doi and Iwasaki 2002) as a age et al. 1996), viability (Brundage et al. 1996), and tool to explore interactions with genes that encode canspicule protraction (Garcia et al. 2001). The vertebrate didate downstream molecules. Double-mutant strains G q family is involved in pertussis-toxin-insensitive reguwere constructed to analyze interactions with the PLC lation of phospholipase C (PLC ) isoforms (Exton signaling pathway and to analyze interactions with re1996). Like its vertebrate homolog, EGL-30 can stimuspect to the pathway defined as downstream of EGL-30 late endogenous phospholipase activity in COS-7 cells with respect to synaptic transmission (Lackner et al. (Brundage et al. 1996). 1999). We focused primarily on egg-laying behavior Given the fact that EGL-30 and G q and G 11 share since this behavior is regulated by neural input to the 80% identity at the amino acid level and that EGLvulval muscles by only two classes of motor neurons, 30 can functionally complement G q (Brundage et al. the hermaphrodite-specific neurons (HSNs) and the ventral type C neurons (VCs) (White et al. 1986; Waggoner et al. 1998). We also examined the double mu1Corresponding author: Howard Hughes Medical Institute and Divitants with respect to pharyngeal-pumping behavior sion of Biology, California Institute of Technology, Pasadena, CA 91125. E-mail: [email protected] since egl-30 mutants display strong pumping defects. Genetics 165: 1805–1822 (December 2003) 1806 C. A. Bastiani et al. served such that a tail spike and vacuolization of some of the Our results suggest that PLC , the only well-characternerve ring ganglia was apparent in the double mutant, but ized effector for vertebrate G q family members, is not not in either single mutant. In all cases, double mutants were the only effector for EGL-30. With respect to egg laying, backcrossed to N2 and, after picking F1’s to individual plates, PLC either acts in parallel to egl-30 or is a minor downeach single mutant was reisolated in the F2 progeny. Construction and integration of functional GFP-tagged stream component of EGL-30-mediated signaling. ConEGL-30, hsp-16::egl-30(QL), and overexpression and integrasistent with this result, mutations in itr-1, which encodes tion of the wild-type egl-30 locus: Standard molecular biologithe single inositol 1,4,5 triphosphate (IP3) receptor, and cal techniques were performed as described (Sambrook et in a gene that encodes protein kinase C (PKC) also do al. 1989). For construction of an in-frame green fluorescent not significantly modify egl-30 gain-of-function phenoprotein (GFP) fusion just 5 to the egl-30 initiator ATG, the following primers were used to amplify a GFP S65T mutant types. However, with respect to pharyngeal pumping, from a pRSET vector (kind gift from Roger Tsien): 5 -AAT each of the mutations in genes that encode components AAAGGCCTAAATGGCCATGAGTAAAGGAGAAGAACTT of PLC signaling do suppress egl-30 gain-of-function TTC-3 /5 -TTAGCAGGCCATGGCGGCCAAGCATTTGTAT phenotypes to a similar extent with respect to pharynAGTTCATCCATGC-3 . The PCR product was gel purified geal pumping. (QiaexII, QIAGEN, Valencia, CA), digested with SfiI, and cloned into the SfiI site of pLB2 (Brundage et al. 1996). The We conclude that in C. elegans there are other effecresulting construct, pCB50, was injected into egl-30(md186); tor(s) for EGL-30 in addition to PLC and that different dpy-20(e1282) at a concentration of 5 ng/ l. Animals were downstream pathways predominate to control egg laymicroinjected according to standard procedures (Mello et ing and pharyngeal pumping. Expression analyses also al. 1991; Mello and Fire 1995). The dpy-20 rescuing plasmid, indicate that there is not complete overlap with respect pMH86, was injected at 20 ng/ l (Han and Sternberg 1990) and was used as the coinjection marker. pBluescript was into EGL-30 localization and EGL-8 localization (Miller cluded as carrier DNA to bring the total DNA concentration et al. 1999). It is conceivable that different effector pathto 200 ng/ l. ways are cell-type specific, and we show that EGL-30 A fusion of the egl-30(Q205L) cDNA was cloned into pPD49.78 does function in, or via, at least one class of motor as a Kpn1-SacI fragment to generate pLB24. pLB24 was at injected at 50 ng/ l as described for pCB50. neurons that activate the vulval muscles and likely in Transgenic arrays (pLB24 and pCB50) were chromosomally the vulval muscles themselves as well. integrated as described (Way et al. 1991), except that animals were treated with 38 Gy from an X-ray source. The pLB24 integrant was named syIs38, and the pCB50 integrant was MATERIALS AND METHODS named syIs105. Construction of and expression from the extrachromosomal array that was integrated (syEx125) to make Manipulation of C. elegans : Maintenance and manipulation syIs36 by the procedures described for other integrated lines of C. elegans were as described (Brenner 1974). The following (Brundage et al. 1996). The integrated lines were outcrossed alleles were used for behavioral analyses and for doublea minimum of six times with dpy-20(e1282). The integration mutant constructions: LGI, egl-30(md186)I (Miller et al. 1996), of the transgenic arrays generally increased the expressivity egl-30(ad805)I (Brundage et al. 1996), and unc-13(e51) uncof the phenotype observed in the nonintegrated lines. In the 122(n2916) I (Brenner 1974); LGII, tph-1(mg280)II (Sze et al. case of syIs38, the severity of the phenotype after heat shock 2000); LGIV, dpy-20(e1282)IV (Hosono et al. 1982), itr-1(sa73) also increased. IV (Iwasaki et al. 1995), dpy-9(e12)IV (Brenner 1974), and Expression analysis: An EGL-30 antibody was generated in tpa-1(k530)IV (Tabuse and Miwa 1983); LGV, egl-8(md1971)V rabbits against the C-terminal peptide: KDTILQHNLKEYNLV (Miller et al. 1999), egl-8(n488)V (Trent et al. 1983), egl-8 (Quality Controlled Biochemicals). The antibody was affinity (sa47)V (Thomas 1990), and egl-1(n487)V (Trent et al. 1983). purified with the peptide used for immunization using SulfoThe unc-13 strain used in this study (CB51) also contains a Link Coupling Gel (Pierce, Rockford, IL) according to the linked unc-122 mutation. This linked mutation was uncovered manufacturer’s instructions. Indirect immunofluorescence in Richmond et al. (1999) and was presumably used in all was done as described (Ruvkun and Giusto 1989), except similar studies prior to this discovery (Lackner et al. 1999). 2 fixation buffer contained 50% MeOH and did not contain In general, mutations were followed in crosses on the basis n-heptane, and Triton X-100 was used at 0.1%. Either a fluoof their own visible phenotypes. For strains harboring tpa-1, rescein-conjugated anti-rabbit antibody was used at 1:1000 dpy-9(e12) was used as a balancer, and for strains with itr-1, (Vector Laboratories, Burlingame, CA) or the Vectastain Elite dpy-20(e1282) was used as a balancer in trans. For example, ABC avidin/biotin blocking kit was used with a biotinylated egl-30(gf)/ males were mated to dpy-9 hermaphrodites. Since anti-rabbit antibody (Vector Laboratories). When the biotinylegl-30(md186sy676) is semidominant, it was possible to identify ated antibody was used, an avidin/biotin blocking step was heterozygous male progeny. Hyperactive (egl-30(md186sy676)/ included after the collagenase digestion step. Animals were ; dpy-9/ ) F1 males were mated with tpa-1 mutant hermaphexamined with a Zeiss axioskop under a 100 objective. For rodites. A total of 10 hyperactive (egl-30(md186sy676)/ ) F1 examination of GFP fluorescence, animals were examined on progeny were selected and picked onto individual plates. A a Leica DMIRBE confocal microscope. total of 25 candidate egl-30(md186sy676) homozygous animals Isolation of intragenic suppressor mutations: Ethyl methwere selected only from plates that segregated dpy-9. Plates anesulfonate (EMS) mutagenesis of 60,000 egl-30(md186) that segregated only hyperactive non-Dpy progeny were examgametes was done as described (Brenner 1974) using 50 mm ined for progeny that segregated hyperactive animals of which EMS. From this screen, we isolated two intragenic revertants approximately one-fourth had a modified phenotype. In the and three strong extragenic suppressor mutations. F2 progeny cases of itr-1 and tpa-1, both mutations slightly modified the were selected on the basis of their ability to suppress eggmovement of egl-30(gf) homozygotes. egl-30(gf); itr-1(sa47) anilaying and/or movement defects of egl-30(md186) mutants. mals were scrawnier than egl-30(gf) homozygotes and in eglIntragenic suppressor mutants were outcrossed to N2 at least six times. 30(gf); tpa-1 double mutants a synthetic phenotype was ob1807 C. elegans G q Expression and PLC Signaling Sequencing of egl-30 mutations: Suppressor mutations (sup) worms in PBS buffer containing 1 mm magnesium chloride and 0.4% SDS. Worms were stained for 1 hr at room temperawere picked as potential intragenic revertants on the basis of the inability to isolate egl-30(md186) homozygous F1 progeny ture, harvested, and washed three times in PBS containing 0.5% Tween-20. Animals were examined for fluorescence on when sup egl-30(md186)/ males were mated to egl-30 (md186). Fragments of the egl-30 locus were amplified using a Zeiss axioscope. Western analysis: Worms were harvested from NGM plates Takara LA-Taq (PanVera) with the following primer sets: 5 -GCATCGAACTTCTATCCTC-3 /5 -GCTACGAGATATTT in M9 and washed one time with M9. Worm pellets were resuspended in 2 SDS sample buffer (Novex, San Diego) GTTGC-3 (exons 1 and 2), 5 -GAGATTAAAATACTCAT TTCG-3 /5 -CGAAAAAAGCATCAGAGATTG-3 (exons 3–5), and heated at 70 for 10 min. Worm debris was pelleted at 14 K in a microcentrifuge for 10 min, and the supernatant and 5 -CTTTCTGTAAATTGTCAGC-3 /GTGGTGTCTCACTC GACC-3 (exons 6–8). DNA was amplified in 10 50l reactions, was promptly loaded on an SDS/PAGE gel (Novex). For Western analysis of EGL-30, the same number of syIs36 gel purified using Qiaex II (QIAGEN), and directly sequenced on an automated sequencer (ABI). The DNA was compared mutants was first picked to separate plates for each time point. Four days later (prior to starvation) worms were heat-shocked with N2 and with the original egl-30(md186) strain. Mutations were confirmed by sequence from the reverse strand. Mutafor 30 min at 32 . At the indicated time points, worms from each plate were harvested and prepared as described above. tions were mapped onto known crystal structures using Protein Explorer (http://www.umass.edu/microbio/chime/explorer/ Worm extracts were loaded onto a 10% gel. For analysis of egl-8 expression, worms were harvested in index.htm). egl-30(tg26) was isolated in a screen for suppressors of unc-31 by L. Khan (Doi and Iwasaki 2002) and obtained M9 as above. Extracts for analysis of egl-8 expression were loaded onto a 4–12% gradient gel (Novex). as a generous gift from the Iwasaki laboratory. Sequencing of egl-8 mutations: Primers flanking the n488 Electrophoretic transfer was carried out for 1.5 hr for EGL30 Western analysis and overnight for EGL-8 analysis. Followdeletion were used for PCR: 5 -CTA CTA CCC AAC AAG TGA GAG 3 /5 -CGG AAG TTT TGG GCT GTT TTG G-3 . The ing transfer to nitrocellulose membranes, EGL-8 antibody (generously provided by Kenneth Miller) was used at a concendeletion was found to extend from 7905–9735 in the unspliced DNA sequence displayed in WormBase (WS62) such that the tration of 1:1000 (Miller et al. 1999), and affinity-purified EGL-30 antibody generated against the peptide was used at a sequence 5 -GTGTGGGAAAAAATGTGT-3 was fused to 5 -TGTTGATTATCATTTTCT-3 . Primers flanking the dilution of 1:50,000. HRP-linked anti-rabbit IgG (Amersham, Buckinghamshire, UK) was added at a concentration of md1971 mutation were used for PCR: 5 -CGA AGA CCC GAC 1:1000, and bands were visualized using enhanced chemilumiAGA ACA TT-3 /5 -CCC GGG TAT TAC CTT CGT CT-3 . PCR nescence (Amersham). products were amplified, purified, and sequenced as above. Behavioral assays: To measure pharyngeal pumping rates, 1day-old adults were placed on nematode growth media (NGM) RESULTS plates seeded with OP50 and left undisturbed for at least 15 min before counting. Pharyngeal pumps were measured using Expression of egl-30: To clarify the site and mode of a counter for a period of 3 min. Response was measured only action for egl-30 with respect to the behaviors that it from animals that remained in food throughout the period of observation. regulates, to resolve differences in the inferred siteTo characterize egg-laying behavior, animals were examined of-action from previous reports (Brundage et al. 1996; 24–28 hr after selecting them as L4 larvae. Young adults were Lackner et al. 1999), and to examine the subcellular placed on fresh plates seeded with OP50 and newly laid eggs localization of egl-30, we sought to construct a rescuing were examined every 5 min for their developmental stage GFP fusion transgene. This transgene contains all of using a Wild M420 macroscope and then removed from the plate. In all cases, at least two trials were performed on differthe presumptive 5 -transcriptional regulatory sequences, ent days, and at least 10 different adults were assayed per trial. introns, and presumptive 3 regulatory sequences for For mutants that never laid eggs past the gastrulation stage egl-30, in addition to the coding sequences for GFP just of development, at least three trials were performed. 5 of the egl-30 initiating methionine. We expected that For response to 5-hydroxytryptamine (5-HT; Sigma, St. this transgene should be appropriately expressed as well Louis), levamisole (Sigma), and -methyl 5-hydroxytryptaas appropriately localized. This transgene was integrated mine ( -methyl 5-HT; Sigma), animals were tested singly (except as indicated) as 1-day-old adults in wells of a microtiter into the genome of egl-30(md186) animals, and the inteplate containing a solution of the indicated drug. Response grated transgene, syIs105, was found to partially rescue was measured after 60 or 90 min, as indicated in figure legends. egl-30(md186) with respect to egg laying, movement, pha5-HT was generally used at a concentration of 7.5 mm, levamiryngeal pumping, and response to neurotransmitters in sole at 6.25 m, and -methyl 5-HT at 1 mm. For 5-HT and egg-laying assays (Tables 1 and 2). Expression was first levamisole, we used M9, but sodium phosphate was substituted for potassium phosphate. To test response to -methyl 5-HT, observed in early embryos at cell peripheries and in assays were performed in water since M9 inhibited the rea punctate pattern throughout embryos (Figure 1D). sponse for all genotypes tested, except for strains that also Later, expression was observed in larvae in the nerve contained egl-1 mutations. ring and many neurons of the nerve ring ganglia, phaPhalloidin staining: Worms were stained with phalloidin ryngeal muscle, and ventral cord and many neurons in using a modification of a previously described protocol (Myers et al. 1996). Worms were grown on NGM plates, harthe tail ganglia and hypodermis (Figure 1). Highest vested in S-basal medium, and washed once with S basal. Superexpression levels were observed in L4 larvae and in adult natant was removed with a Pasteur pipette and worms were animals. In the nervous system, expression was observed frozen in liquid nitrogen. A few drops of ice-cold acetone were in cell bodies and in neural processes. However, the added to worms and worms were incubated on ice for 5 min. highest expression was observed in the axons of the Acetone was removed and worms were air dried. A total of 10 g of fluorescein-conjugated phalloidin was added to the nerve ring. Expression in larvae and in adults was also 1808 C. A. Bastiani et al.